Subtype of Diabetes Mellitus związany z mutacją mitochondrialnego DNA ad

Kwestionariusze lub bezpośrednie badanie pacjentów i ich krewnych wykorzystano do stwierdzenia obecności cukrzycy, rodzaju cukrzycy, schematu leczenia i zdolności wydzielniczej insuliny, a także do określenia, czy towarzyszące objawy, takie jak utrata słuchu, osłabienie mięśni, oftalmoplegia i upośledzenie umysłowe były obecne. Rozpoznanie cukrzycy w tych przypadkach opierało się na kryteriach Światowej Organizacji Zdrowia, i podatnych na ketozę pacjentów zdefiniowano jako klinicznych IDDM. Badanie zostało zatwierdzone przez odpowiednie komitety ds. Przeglądu instytucjonalnego, a wszystkie podmioty wyraziły świadomą zgodę. Badania molekularne
DNA przygotowano z leukocytów krwi obwodowej. Fragmenty mitochondrialnego DNA obejmujące pozycję 3243 zamplifikowano za pomocą reakcji łańcuchowej polimerazy (PCR). Starter przedni to 5 AGGACAAGAGAAATAAGGCC3 , obejmujący pozycje od 3130 do 3149, a starter odwrotny to 5 CACGTTGGGGCCTTTGCGTA3 , obejmujący pozycje od 3423 do 340417. Uzyskane fragmenty mitochondrialnego DNA o długości 294 bp (od 3130 do 3423) strawiono ograniczeniem endonukleaza, Apal i analizowana za pomocą elektroforezy w żelu agarozowym (0,8 procent). Produkty PCR sekwencjonowano bezpośrednio18 lub subklonowano do wektora plazmidowego, a następnie sekwencjonowano.
Pojemność wydzielnicza insuliny i badania cęgów euglikemicznych
Pojemność wydzielniczą insuliny oceniano przez pomiar stężeń insuliny w osoczu lub peptydu C podczas 75-g doustnego testu tolerancji glukozy lub po dożylnym podaniu glukagonu (1 mg) lub przez pomiar peptydu C w 24-godzinnej próbce moczu. Obwodowy pobór glukozy (głównie przez mięśnie szkieletowe) mierzono u jednego pacjenta z IDDM i jednego pacjenta z NIDDM, obaj mieli tę mutację, podczas badania zacisku euglikemiczno-hiperinsulinemicznego19.
Analiza statystyczna
Zmienne ciągłe zostały porównane za pomocą testu t-Studenta, a zmienne kategoryczne porównano za pomocą analizy chi-kwadrat. Wszystkie wartości P są dwustronne.
Wyniki
Identyfikacja mutacji
Rysunek 1. Rysunek 1. Identyfikacja mutacji A-to-G w pozycji 3243 mitochondrialnego tRNA leucyny. Panel A pokazuje sekwencje mitochondrialnego DNA otaczającego zmutowane miejsce w mitochondrialnym Leu TRNA (UUR) od osobnika II-2 z rodziny 2. Fragmenty mitochondrialnego DNA amplifikowano za pomocą PCR, a produkty subklonowano do wektora plazmidowego i sekwencjonowano jak opisano. w sekcji Metody. W panelu B fragmenty 294-bp (3130 do 3423) mitochondrialnego DNA obejmujące pozycję 3243 uzyskano od trzech osobników i przygotowano przez PCR, strawiono Apal i analizowano za pomocą elektroforezy w żelu agarozowym (0,8 procent). Podatne osobniki są heteroplazmatyczne dla mutacji.
Tabela 1. Tabela 1. Charakterystyka rodzin z cukrzycą związaną z mutacją A do G w pozycji 3243 tRNA mitochondrialnego leucyny. Zidentyfikowaliśmy mutację A-to-G w pozycji 3243 mitochondrialnego leucyny tRNA u 16 pacjentów z grup od do 5 (ryc. 1). Figura 1A pokazuje sekwencje obejmujące pozycję 3243 w prawidłowym i zmutowanym DNA mitochondrialnym od jednego pacjenta (Temat II-2 w Family 2)
[patrz też: komórki merkla, krzysztof wanio, paradygmaty zdrowia ]